Escherichia coli in West Bengal: active surveillance of uropathogenicity, ESBL, MDR and XDR

INTRODUCTION

Escherichia coli (E. coli) is the most prevalent facultative anaerobic enteric bacteria commonly found in the environment, food, and gastrointestinal tract of humans and animals.¹ The most frequent etiologic agent, Uropathogenic Escherichia coli (UPEC), is currently accountable for over 90% of all Urinary tract infections (UTIs) that occur worldwide.² Most cases of E. Coli infection occur when patients use community care services, are hospitalized, or consume vegetables contaminated by inadequately cleaned water or biocide compounds used during cultivation.^1,3 The recent development of antimicrobial resistance in E. coli is of particular concern due to its ability to spread easily and its potential to cause serious infections.^4,5 The global community has reported multi-drug resistance (MDR) and extensive drug resistance (XDR) E. Coli resistance to most first-line antimicrobial drugs, including cotrimoxazole, ampicillin, and nitrofurantoin.³ MDR is facilitated by a wide range of intricately interconnected processes, including target protection, enzyme inactivation, and drug efflux.^6,7 Production of extended-spectrum β-lactamase (ESBL) is one of the major reasons causing MDR.⁶ Unfortunately, Enterobacteriaceae that produce β-lactamases exhibit resistance to most commonly used antibiotic classes, including aminoglycosides, trimethoprim-sulfamethoxazole, and fluoroquinolones.⁸ This poses a great deal of difficulties and leaves very few therapeutic options in a clinical setting.^8,9 Therefore, monitoring these Enterobacteriaceae that produce β-lactamase is crucial for providing clinical care.⁸

Whole genome sequencing (WGS) is gradually taking the place of phenotypic antimicrobial susceptibility testing in many affluent nations’ anti-microbial resistance (AMR) surveillance systems.¹⁰ However, surveillance systems are still not well established in many low- and middle-income countries because of their high expenses.¹¹ Research has indicated that the disc diffusion method (DAD) is an economical approach that can produce outcomes that are on par with other phenotypic techniques for assessing antibiotic susceptibility, including broth microdilution or agar dilution methods.¹²

In India, the prevalence of ESBL, AmpC, and metallo-β-lactamase (MBL) producing E. coli has been increasing steadily in recent years.⁸ This is of particular concern as ESBL-producing E. coli can cause severe infections, including urinary tract infections, bacteremia, childhood diarrhea, septicemia, hospital-acquired pneumonia, intra-abdominal abscess, brain abscess, device-related infections, and meningitis.¹³ The goal of the current investigation was to ascertain the prevalence of MDR, XDR, and ESBL E. coli in our geographic region because there has been no documentation addressing its prevalence concerning UTIs.

METHODS

Study design

This cross-sectional study involves patients who had UTIs who received medical treatment across primary, secondary, and tertiary care facilities in West Bengal.

Study population

From 2020 to 2022, people with recurrent UTIs who were treated at primary, secondary, and tertiary healthcare facilities in West Bengal were included in the study. Patients with bacterial infections other than UTIs were excluded.

Sample size calculation

For estimating the prevalence, the sample size was calculated using Scalex Calculator considering the expected prevalence of 95% from the pilot study conducted in our laboratory in 2020 and the potential loss/attrition of 5% with the absolute precision of ±5%.¹⁴ Formula used for sample size calculation is as follows:

Where, n=sample size, Z=Z score for level of significance, P=expected prevalence (if the expected prevalence is 20%, then P=0.2), and d=precision (if the precision is 5%, then d=0.05).

Collection of bacterial strains

From 2020 to 2022, pre-cultured clinical samples were obtained from different UTI patients at different hospitals and private laboratories located in West Bengal, including North 24 Pargana, South 24 Pargana, East Midnapur, West Midnapur, Howrah, Durgapur, Murshidabad and Kolkata. The sample source of these isolates was urine. The collected samples were streaked onto MacConkey agar and then incubated at 37˚C for 24 h and stored in the refrigerator at 4˚C for future usage. In addition, reference strains E. coli ATCC 25922, ATCC 35218, Klebsiella pneumoniae ATCC 700603, and ATCC 25955 were used for comparison.

Identifications of bacterial strains

Identification of bacterial isolates was carried out using Gram staining, conventional biochemical methods (IMViC testing), and the presence of E. coli-specific 16s rRNA.^15,16

Antibiotic susceptibility testing

Following guidelines from the Clinical Laboratory Standard Institute (CLSI), all isolates that were verified to be E. coli were tested using the Kirby-Bauer disc agar diffusion (DAD) method for antibiotic sensitivity to a panel of 16 different drugs. The concentrations of each disc’s antibiotics were amoxicillin-clavulanic acid 20/10 μg (AMC), amoxicillin 10 μg (AMX), azithromycin 15 μg (AZI), cefoxitin 30 μg (FOX), cefotaxime 30 μg (CTX), chloramphenicol 30 μg (CHL), levofloxacin 5 μg (LEV), cotrimoxazole 1.25/23.75 μg (COT), imipenem 10 μg (IMP), fosfomycin 200 μg (FOS), amikacin 30μg (AMK), tetracycline 30 μg (TET), nitrofurantoin 300μg (NTF), cefixime 5 μg (CFX), ceftazidime 30 μg (CTZ) and aztreonam 30 μg (AZT). The sizes of the inhibition zones surrounding the discs impregnated with antibiotics were measured and compared to the Clinical and Laboratory Standard Institute (CLSI) clinical breakpoints after rounding off to the nearest integer, to determine if each bacterial isolate is resistant, intermediate, or susceptible.

All the bacterial isolates that are not susceptible (i.e., intermediate and resistant) to third-generation cephalosporins (cefotaxime and ceftazidime), cefoxitin, and imipenem were expected to have a phenotype reflecting ESBL- or AmpC or MBL production. Suspected beta-lactamase-producers were discriminated by the combination disc test (CDT) according to CLSI and European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines using a second panel of 12 antibiotic-impregnated discs.

According to CLSI guidelines ceftazidime (30 μg), ceftazidime-clavulanate (30/10 μg), ceftazidime-phenylboronic acid (30/300 μg), ceftazidime-phenylboronic acid-clavulanate (30/300/10 μg) and imipenem (10 μg) discs were used to determine ESBL and AmpC producer.¹⁷ In accordance with the EUCAST standards, suspected beta-lactamase-producing bacteria were distinguished using another 2 panels of eight antibiotic-impregnated discs, with 4 discs in each panel. First panel contains discs impregnated with cefotaxime (30 μg) (CTX), cefotaxime/clavulanic acid (30/10 μg) (CEC), cefotaxime/cloxacillin (30/200 μg) (CTC), and cefotaxime/clavulanic acid/cloxacillin (30/10/200 μg) (CCC). Antibiotic-impregnated discs in the second panel were meropenem (10 μg) (MRP), meropenem-phenylboronic acid (10/200 μg) (MRB), meropenem-cloxacillin (10/200 μg) (MCL), meropenem-EDTA (10/750 μg) (MRE). The results of these CDT were interpreted according to Shoorashetty et al and EUCAST guidelines.¹⁷

E. coli ATCC 25922, ATCC 35218, Klebsiella pneumoniae ATCC 700603, and ATCC 25955 were used as quality control strains.

Genotypic characterization of E. coli, ESBL, and uropathogenic genes by PCR

The E. coli gene (16S rRNA), ESBL gene (bla_TEM, bla_SHV, bla_CTX-M), and uropathogenic gene (UPEC c3509) were detected in collected E. coli samples isolated by polymerase chain reaction (PCR) and confirmed by agarose gel electrophoresis. Briefly, bacterial genomic DNA was extracted from the isolates using the Himedia DNA isolation kit and measured by Spectrophotometer (260/280) for its purity and concentration. PCR was performed in 25 μl PCR volume using 5 μl of DNA template, 1 μl of each gene-specific primer (bla_TEM: F-TTGGGTGCACGAGTGGGTTA, R-TAATTGTTGCCGGGAAGCTA, T_a - 55˚C; bla_SHV: F-AGGATTGACTGCCTTTTTG, R-ATTTGCTGATTTCGCTCG, T_a - 53˚C; bla_CTX-M: F-CGATGTGCAGTACCAGTAA, R-TAGGTCACCAGAACCAGCGG, T_a - 53˚C; E. coli 16S RNA: F- GGAAGAAGCTTGCTTCTTTGCTGAC, R-AGCCCGGGGATTTCACATCTGACTTA, T_a - 60˚C; UPEC c3509: F- ACAATCCGCCACCATCCA, R-ACAATCCGCCACCATCCA, T_a - 58˚C), and 12.5μl of Hi-Chrom PCR master mix (Himedia).^2,16,18,19 The products were placed for electrophoresis. The cycling parameters were as follows: 95°C for 2 minutes followed by 45 cycles of 95°C for 1 minute, specific annealing temperature (T_a) for 30 sec, and 72˚C for 1 minute, with a final extension at 72°C for 10 minute.

5 μl of the PCR product was mixed with 1 μl loading buffer and separated on a 2% agarose gel containing 0.5 μg/ml of ethidium bromide in TAE buffer. UV light was used to visualize amplified products (Figure 6-10).

Data analysis

The prevalence proportion of bacteria resistant to each tested antibiotic was, expressed as a percentage and the Clopper-Pearson interval reflecting 95% binomial proportions were used to calculate confidence intervals using SPSS software. The fraction of samples containing bacteria that are resistant or intermediate to antimicrobials was determined by dividing the number of samples with non-susceptible bacteria by the total number of samples collected.

RESULTS

For the expected prevalence of 95%, the required sample size was calculated to be 77 for the margin of error or absolute precision of ±5% in estimating the prevalence with 95% confidence and considering the potential loss/attrition of 5%. In this investigation, 77 patients with a mean age of 46.37037±11.4928 were included. The majority of participants were female, accounting for 62.34% of the samples. While 68.83% reported using shared toilets, 35.06% experienced more than two episodes of infections in six months. For sanitation, the majority were using groundwater. The characteristics of the patients that were part of this investigation are summarized in Table 1. All these 77 precultured clinical samples were confirmed to be E. coli by IMViC screening and the presence of E. coli-specific 16S RNA gene (Figure 6A).

A dominant type of resistance, based on the DAD results (Figure 1-3), was found to amoxicillin and amoxicillin-clavulanate conjugates with a 95% CI of 93.0-100.0 followed by ceftazidime (92.2%; 95% CI: 83.8-97.1), cefotaxime (92.2%; 95% CI: 83.8-97.1), cefixime (75.32%; 95% CI: 64.2-84.4), aztreonam (75.32%; 95% CI: 64.2-84.4), nitrofurantoin (61.03%; 95% CI: 49.2-72.0) and azithromycin (55.84%; 95% CI: 44.1-67.2). A maximum of the samples was susceptible to imipenem leaving only 12.98% (95% CI: 6.4-22.6) of resistance to it (Table 2) (Figure 4). All these isolates were resistant to more than one antibiotic but only 67 (87.01%; 95% CI: 77.4-93.6) showed resistance to at least one agent in three different antimicrobial categories. In addition, 2 (2.59%; 95% CI: 0.3-9.1) of them showed sensitivity to only one or two antimicrobial classes while resistant to all others.

The phenotypic profile of all the non-susceptible isolates to third-generation cephalosporins is shown in Figure 5. From all the samples tested 65 (84.41%; 95% CI: 74.4-91.7) were ESBL, 24 (31.16%; 95% CI: 21.1-42.7) were AmpC and 5 (6.49%; 95% CI: 2.1-14.5) were MBL producers. The CDT method also revealed that 23 (29.87%; 95% CI: 20.0-41.1) isolates were co-producers of ESBL and AmpC.

#SD= Standard Deviation.

In accordance with the Clinical Laboratory Standards Institute (CLSI) human clinical break points, pink, light blue, and light green fields represent numbers of isolates with inhibition zone diameters for resistant, intermediate and susceptible Enterobacteriaceae, respectively. TET: tetracycline, AMK: amikacin, NFT: nitrofurantoin, FOS: Fosfomycin, AMX: amoxicillin, CFX: cefixime, AZI: azithromycin, LEV: levofloxacin, IMP: imipenem, COT: cotrimoxazole, CHL: chloramphenicol, CTZ: ceftazidime, CTX: cefotaxime, AZT: aztreonam, AMC: amoxicillin-clavulanic acid, FOX: cefoxitin. ATB: Antibiotic, R: resistance, CI: Confidence intervals were calculated as 95% binomial proportions and presented as Clopper-Pearson interval.

All the collected isolates were confirmed to be Escherichia coli by genotypic sequencing 16s rRNA. Occurrences of ESBL-specific genes were found in 71 (92.2%; 95% CI: 83.8-97.1) isolates. The most common ESBL encoding gene detected was bla_CTX-M (75.3%; 95% CI: 64.2-84.4) followed by bla_TEM (62.3%; 95% CI: 50.6-73.1) and bla_SHV. (22.1%; 95% CI: 13.4-33.0) (Figure 6 B-D). Among these 77 clinical isolates, 62 (80.5%; 95% CI: 69.9-88.7) samples were harboring the uropathogenic gene UPEC c3509 (Figure 6E).

DISCUSSION

Antimicrobial resistance is spreading throughout the world, endangering both efficient infection prevention and treatment as well as global public health.²⁰ Acinetobacter sp. showed the highest levels of resistance, followed by E. coli, according to the European Antimicrobial Resistance Surveillance Network and the U.S. National Healthcare Safety Network.²¹ According to reports from multiple research conducted in Indian hospitals, the prevalence of E. Coli that produces ESBL is higher than that of AmpC and carbapenemase.²² In South India, 53% of patients suffering from community-acquired bacteremia carry drug-resistant E. coli.²³ Among MDR Gram-negative bacteria isolated from neonatal septicemia in tertiary institutions, the most frequent ones are Acinetobacter, Klebsiella and E. coli.²⁴ Likewise, the most common microorganisms responsible for pediatric urinary tract infections (UTIs) are E. Coli and Klebsiella Sp.^25,26 One of the most prevalent infectious disorders worldwide is urinary tract infection, which can be brought on by both Gram-positive and Gram-negative bacteria.²⁷ When compared to Gram-positive bacteria, studies discovered that Gram-negative bacteria were more common culprits in UTIs.²⁸ E. coli is the major pathogen responsible for UTIs, according to numerous research.²⁹ cases of UTIs increased by 60.40% from 1990 to 2019 worldwide.³⁰

In our study, we found 87% of the patients, taking primary, secondary, and tertiary care treatment, are infected with MDR-E. coli. with the highest resistance to amoxicillin, third-generation cephalosporins, cephamycins, monobactams, macrolides, and nitrofurans. A study conducted in Mumbai, India, showed that cases of MDR gram-negative bacteria increased steadily from 2012-2014. An estimated 700,000 fatalities globally occur due to MDR bacteria each year, and by 2050, that number is expected to rise to 10 million deaths.³¹ In addition, 2 of the total 77 cases were found to be extensively drug-resistant (XDR) leaving only one or two antimicrobials in the treatment regimen. Production of ESBL, AmpC, and MBL are the major reasons behind this multi-drug resistance. According to several additional Indian research, the prevalence of ESBLs is between 60 and 89%.^8,32,33 The prevalence, according to our current investigation, is 92.2% (genotypically). In line with earlier research from India, 31.16% and 6.49% of the E. coli in our investigation produced Amp C and MBL respectively.³⁴ Co-existence of ESBL and AmpC was observed in 29.81% of isolates and 12.98% of E. coli samples exhibit carbapenem resistance.

ESBL producers also showed cross-resistance to aztreonam, cefixime, nitrofurantoin, azithromycin, and tetracycline. The most prevalent gene for producing ESBL in E. coli was bla_CTX-M, followed by bla_TEM and bla_SHV respectively. Cefotaxime (and ceftriaxone) are significantly preferred substrates by bla_CTX-M over ceftazidime.^35,36 However, in our investigation, we found equivalent resistance to both ceftazidime and cefotaxime. Some previous studies evidenced that isolates harboring a bla_CTX-M-32, a member of bla_CTX-M-1, exhibit resistance to both ceftazidime and cefotaxime in a similar manner.³⁷

Many individuals experience UTIs, which are frequent bacterial infections.³⁸ Women are more likely than males to get a UTI and ESBL-positive E. coli frequently cause complicated UTIs.³⁹ The use of common toilets and contaminated groundwater worsens the situation by spreading the infection. In our investigation, 80.5% of clinical isolates were uropathogenic and all of them were ESBL positive. This finding is also in concordance with some previous studies conducted in India.⁴⁰ Of all cases, 35.06% experienced more than 2 episodes of infection within 6 months, and all of them were infected with E. coli harbouring more than one ESBL-producing gene.

The initial two years of the study took place during the COVID-19 pandemic, a time when healthcare facilities were overcrowded, elevating the risk of infection transmission. Conversely, some individuals adhered to the quarantine measures, avoided social gatherings and practiced proper sanitation. Consequently, the probability of infection transmission was decreased. As a result, the findings from this period may not fully reflect the current situation. However, this investigation sheds light on the emergence of antimicrobial resistant uropathogenic E. coli strains and their associated risks.

CONCLUSION

The present study highlights the significant incidence of ESBL, AmpC-producing and carbapenem-resistant E. Coli isolates across West Bengal, India. Concerns are raised about the situation by the fact that these resistant organisms are also cross-resistant (MDR or XDR) to the common medications utilized in clinical settings. The increase in carbapenem resistance is very alarming as carbapenem is considered to be the strongest antimicrobial till date. Genotypic analysis is always found to be the gold standard though phenotypic analysis is done frequently in low- and middle-income countries. In most Indian hospitals, however, it is not a routine procedure to screen for and report multidrug-resistant pathogens. Thus, a collaboration of microbiologists and physicians is strongly advised to monitor patterns of pathogen resistance. The management and prevention of the spread of these resistant bacteria in the hospital setting and community could be aided by selecting the course of treatment, upholding appropriate cleanliness, and conducting epidemiological surveys.

Funding: This research was funded by the Council of Industrial and Scientific Research (CSIR), grant number 08/0749(0001)/2019-EMR-I

Conflict of interest: None declared

Ethical approval: The study was approved by the Department of Physiology, University of Calcutta (Ref. No.: IHEC/SSM/P79/2019)

REFERENCES

1. 1. Rasheed MU, Thajuddin N, Ahamed P, Teklemariam Z, Jamil K. Antimicrobial drug resistance in strains of Escherichia coli isolated from food sources. Rev Inst Med Trop Sao Paulo. 2014;56(4):341-6.
2. 2. Brons JK, Vink SN, de Vos MGJ, Reuter S, Dobrindt U, van Elsas JD. Fast identification of Escherichia coli in urinary tract infections using a virulence gene based PCR approach in a novel thermal cycler. J Microbiol Methods. 2020;169:105799.
3. 3. Olorunmola FO, Kolawole DO, Lamikanra A. Antibiotic resistance and virulence properties in Escherichia coli strains from cases of urinary tract infections. Afr J Infect Dis. 2013;7(1):1-7.
4. 4. Onduru OG, Mkakosya RS, Aboud S, Rumisha SF. Genetic determinants of resistance among ESBL-producing Enterobacteriaceae in Community and hospital settings in east, central, and southern Africa: a systematic review and meta-analysis of prevalence. Can J Infect Dis Med Microbiol. 2021;2021:5153237.
5. 5. Dirar MH, Bilal NE, Ibrahim ME, Hamid ME. Prevalence of extended-spectrum β-lactamase (ESBL) and molecular detection of blaTEM, blaSHV and blaCTX-M genotypes among Enterobacteriaceae isolates from patients in Khartoum, Sudan. Pan Afr Med J. 2020;37:213.
6. 6. Xu Y, Sun H, Bai X, Fu S, Fan R, Xiong Y. Occurrence of multidrug-resistant and ESBL-producing atypical enteropathogenic Escherichia coli in China. Gut Pathog. 2018;10:8.
7. 7. Szmolka A, Nagy B. Multidrug resistant commensal Escherichia coli in animals and its impact for public health. Front Microbiol. 2013;4:258.
8. 8. Govindaswamy A, Bajpai V, Khurana S, Aravinda A, Batra P, Malhotra R, et al. Prevalence and characterization of beta-lactamase-producing Escherichia coli isolates from a tertiary care hospital in India. J Lab Phys. 2019;11(02):123-7.
9. 9. Sheng WH, Badal RE, Hsueh PR. Distribution of extended-spectrum β-lactamases, AmpC β-lactamases, and carbapenemases among Enterobacteriaceae isolates causing intra-abdominal infections in the Asia-Pacific region: results of the study for Monitoring Antimicrobial Resistance Trends (SMART). Antimicrob Agents Chemother. 2013;57(7):2981-8.
10. 10. Manishimwe R, Moncada PM, Bugarel M, Scott HM, Loneragan GH. Antibiotic resistance among Escherichia coli and Salmonella isolated from dairy cattle feces in Texas. PLoS One. 2021;16(5):e0242390.
11. 11. Seale AC, Gordon NC, Islam J, Peacock SJ, Scott JAG. AMR Surveillance in low and middle-income settings- a roadmap for participation in the Global Antimicrobial Surveillance System (GLASS). Wellcome Open Res. 2017;2:92.
12. 12. Hoelzer K, Cummings KJ, Warnick LD, Schukken YH, Siler JD, Gröhn YT, et al. Agar disk diffusion and automated microbroth dilution produce similar antimicrobial susceptibility testing results for Salmonella serotypes Newport, Typhimurium, and 4, 5, 12: i-, but differ in economic cost. Foodborne pathogens and disease. 2011;8(12):1281-8.
13. 13. Reuland EA, Al Naiemi N, Raadsen SA, Savelkoul PH, Kluytmans JA, Vandenbroucke-Grauls CM. Prevalence of ESBL-producing Enterobacteriaceae in raw vegetables. Eur J Clin Microbiol Infect Dis. 2014;33(10):1843-6.
14. 14. Naing L, Nordin RB, Abdul Rahman H, Naing YT. Sample size calculation for prevalence studies using Scalex and ScalaR calculators. BMC Med Res Methodol. 2022;22(1):209.
15. 15. Tripathy N, Sapra A. Gram Staining. In: StatPearls. Treasure Island (FL): StatPearls Publishing; 2023.
16. 16. Sabat G, Rose P, Hickey WJ, Harkin JM. Selective and sensitive method for PCR amplification of Escherichia coli 16S rRNA genes in soil. Appl Environ Microbiol. 2000;66(2):844-9.
17. 17. Shoorashetty RM, Nagarathnamma T, Prathibha J. Comparison of the boronic acid disk potentiation test and cefepime-clavulanic acid method for the detection of ESBL among AmpC-producing Enterobacteriaceae. Indian J Med Microbiol. 2011;29(3):297-301.
18. 18. Bajpai T, Pandey M, Varma M, Bhatambare GS. Prevalence of TEM, SHV, and CTX-M beta-lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna J Med. 2017;7(1):12-6.
19. 19. Kumar A, Mallappa RH, Jaswal A, Kumar B, Kumar N, Hirikyathanahalli R. Genotypic identification of extended spectrum β-lactamase producing Escherichia coli in dairy supply chain. Indian J Dairy Sci. 2021;74(1):61-7.
20. 20. WHO Fact Sheet. Antimicrobial resistance. 2018. Available from: http://www.who.int/en/news-room/fact-sheets/detail/antimicrobial-resistance. Accessed on 12 August 2024.
21. 21. Exner M, Bhattacharya S, Christiansen B, Gebel J, Goroncy-Bermes P, Hartemann P, et al. Antibiotic resistance: What is so special about multidrug-resistant Gram-negative bacteria? GMS Hyg Infect Control. 2017;12.
22. 22. Bhattacharya S. Is screening patients for antibiotic-resistant bacteria justified in the Indian context? Indian J Med Microbiol. 2011;29(3):213-7.
23. 23. Abhilash KP, Veeraraghavan B, Abraham OC. Epidemiology and outcome of bacteremia caused by extended spectrum beta-lactamase (ESBL)-producing Escherichia coli and Klebsiella spp. in a tertiary care teaching hospital in south India. J Assoc Phys India. 2010;58:13-7.
24. 24. Srivastava R, Agarwal J, Srivastava S, Kumar M, Singh M. Multidrug resistant Gram-negative bacilli from neonatal septicaemia at a tertiary care centre in North India: a phenotypic and genotypic study. Indian J Med Microbiol. 2014;32(1):97-8.
25. 25. Behzadi P, Behzadi E, Yazdanbod H, Aghapour R, Akbari Cheshmeh M, Salehian Omran D. A survey on urinary tract infections associated with the three most common uropathogenic bacteria. Maedica. 2010;5(2):111-5.
26. 26. Iqbal Z, Mumtaz MZ, Malik A. Extensive drug-resistance in strains of Escherichia coli and Klebsiella pneumoniae isolated from paediatric urinary tract infections. J Taibah Univ Med Sci. 2021;16(4):565-74.
27. 27. Cohen-Nahum K, Saidel-Odes L, Riesenberg K, Schlaeffer F, Borer A. Urinary tract infections caused by multi-drug-resistant Proteus mirabilis: risk factors and clinical outcomes. Infection. 2010;38(1):41-6.
28. 28. Mandell GL, Bennett JE, Dolin R. Principles and practices of infectious diseases. 7th edn. St Louis: Elsevier; 2010.
29. 29. Nagvekar V, Sawant S, Amey S. Prevalence of multidrug-resistant Gram-negative bacteria cases at admission in a multispeciality hospital. J Glob Antimicrob Resist. 2020;22:457-61.
30. 30. Yang X, Chen H, Zheng Y, Qu S, Wang H, Yi F. Disease burden and long-term trends of urinary tract infections: A worldwide report. Front Public Health. 2022;10:888205.
31. 31. Reale M, Strazzulla A, Quirino A, Rizzo C, Marano V, Postorino MC, Mazzitelli M, Greco G, Pisani V, Costa C, Cesana BM. Patterns of multi-drug resistant bacteria at first culture from patients admitted to a third level University hospital in Calabria from 2011 to 2014: implications for empirical therapy and infection control. Le Infez Med. 2017;25(2):98-107.
32. 32. Kaur J, Mahajan G, Chand K, Sheevani, Chopra S. Enhancing phenotypic detection of ESBL in AmpC co-producers by using cefepime and tazobactam. J Clin Diagn Res. 2016;10(1):Dc05-08.
33. 33. Bora A, Ahmed GU, Hazarika NK. Phenotypic detection of extended spectrum β-lactamase and AmpC β-lactamase in urinary isolates of Escherichia coli at a tertiary care referral hospital in Northeast India. J Coll Med Sci Nepal. 2013;8(3):22-9.
34. 34. Arora S, Bal M. AmpC beta-lactamase producing bacterial isolates from Kolkata hospital. Indian J Med Res. 2005;122(3):224-33.
35. 35. Rossolini GM, D’Andrea MM, Mugnaioli C. The spread of CTX-M-type extended-spectrum beta-lactamases. Clin Microbiol Infect. 2008;14(1):33-41.
36. 36. Chaudhary U, Agarwal S, Raghuraman K. Identification of extended spectrum beta lactamases, AmpC and carbapenemase production among isolates of Escherichia coli in north Indian tertiary care centre. Avicenna J Med. 2018;8(2):46-50.
37. 37. Cartelle M, del Mar Tomas M, Molina F, Moure R, Villanueva R, Bou G. High-level resistance to ceftazidime conferred by a novel enzyme, CTX-M-32, derived from CTX-M-1 through a single Asp240-Gly substitution. Antimicrob Agents Chemother. 2004;48(6):2308-13.
38. 38. Jalil MB, Al Atbee MYN. The prevalence of multiple drug resistance Escherichia coli and Klebsiella pneumoniae isolated from patients with urinary tract infections. J Clin Lab Anal. 2022;36(9):e24619.
39. 39. Eshwarappa M, Dosegowda R, Aprameya IV, Khan MW, Kumar PS, Kempegowda P. Clinico-microbiological profile of urinary tract infection in south India. Indian J Nephrol. 2011;21(1):30-6.
40. 40. Mohapatra S, Panigrahy R, Tak V, Shwetha JV, Sneha KC, Chaudhuri S, et al. Prevalence and resistance pattern of uropathogens from community settings of different regions: an experience from India. Access Microbiol. 2022;4(2):000321.